EST details — SGN-E550967

Search information 
Request: 550967Match: SGN-E550967
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188212Clone name: TUS-54-J18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C36143 [cLEG-37-L10] Trace: SGN-T70770 EST: SGN-E256286 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550967Length: 477 bp (675 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550967 [] (trimmed) CATGAGGGAAGAACATATTACCAGTTTGAATTAGAGCCACCACATGTGATGATCACAGCAACGGCTGCTGGAAATCGCCTATACTTGTTCAATGT
TACTGGAAATGGTCTTCAATGGAAAAGGTATTACAAAGATTTGAGAAAGATCGCTGAGTCTTTCAGGGTTGTCTGAGTTACATCTACCCCATGCG
TGATAGCACCTTAGCAGAGGTGGAATGCACAAGGTAGAAGAGTCGGTCACTATAATCACAATTATTAGAAGCCACATCACCTCTAGTAGTATATA
CAGTTAAATATGTGAGAGGAGAATTTCCTCTAGAATGAGTTTTGGTAACAAAGTTTAGCTACCAATGATTATTGTAAACTGTTTACATTACCAAT
ATTACAAGTCTTCAGAAGGCACCTCTTCTGGATTGATCGCGACATCAGGCATTGATAACTCTGTTTGATTGTCACTACAATCACCTCANAAAAAA
AA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550967] SGN-U562775 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351842 [Download] [View] Facility Assigned ID: TUS54J18_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5