EST details — SGN-E551051

Search information 
Request: 551051Match: SGN-E551051
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188341Clone name: TUS-54-P3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C39208 [cLEG-49-B15] Trace: SGN-T74183 EST: SGN-E258311 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551051Length: 534 bp (664 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551051 [] (trimmed) GTTTTCCGCTCTGCTAAGGTCCGTATTGCTGTATTTAGTCAGCATCATGTTGATGGGCTGGATCTGTCCTCAAATCCCCTCTTATACATGATGCG
TTGCTTTCCAGGAGTGCCTGAACAAAAATTACGTGGTCATCTAGGTTCATTTGGTATAACCGGAAATCTTGCTCTTCAGCCCATGTACACTTTAT
CTGGTGGCCAAAAAAAGCAGAGTTGCATTTGCAAAGATAACTTTCAAGAAACCTCACATATTGCTTCTTGATGAGCCGTCAAATCACTTGGATCT
GGACGCTGTGGAAGCCTTGATACAAGGTCTTGTCTTGTTCCAAGGAGGCGTCCTGATGGTCAGTCACGATGAACATTTAATATCTGGCAGTGTTG
ATCAACTCTGGGCTGTCTCTGAGGGCAGAGTGACGCCTTTTGACGGGACATTCCAAGATTACAAGAAAATATTGCAATCATAAACACTTCTGCTG
CTTTCTGAAGTGAACGAACTATAATTAGTTACTTATGGCCTAAACCCCTACTTTTATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551051] SGN-U566380 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351926 [Download] [View] Facility Assigned ID: TUS54P3_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5