EST details — SGN-E551136

Search information 
Request: 551136Match: SGN-E551136
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188512Clone name: TUS-55-G6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C41563 [cLEG-57-K14] Trace: SGN-T76048 EST: SGN-E261386 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551136Length: 551 bp (793 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551136 [] (trimmed) TTTTTTTTAACAAGAAACAAGTGCAACAAACATTGTATTTAAATCAATAATACTATACAATATAATACAATACAACACAACACACAAGACAATAC
AATACAATACTCTTTATTTGGAACAAAGAGTTTATTTGGTTGGGAATAACAAGTAACACAAGCACAACAAACTGATTGAATAATAAGTTCTATAT
AGACACACTGTTGGGAATGAAACAATTCCGTCCACTGCAATGCTGAATTCAACAGTGGAGATTTTTGAGCAACGTTTTATGACTGGTGCGGGCAA
AAACCTTCCTGAACATGCAATGATTTGCATGATAAATCGTGAAGAGTCAGTCATGAGCGAGCTGTGCTTAGACGCCCCTGCCGTGGATGATCCGG
ACAAGTTATTCGCTAATACATTGTTTGAGGTTGTATTCAATGAGAGCCGGAATTTGCCATTCATTTTGTTCGTGAAAGATGCTGACAAAGTAATG
GCAGGAAACGCAGAATTATATTCAACATTTAAAACTCGGCTTGAGAAACTTCTTAATAATGTAATTATTATTGGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551136] SGN-U579694 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352011 [Download] [View] Facility Assigned ID: TUS55G6_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5