EST details — SGN-E551150

Search information 
Request: 551150Match: SGN-E551150
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188567Clone name: TUS-55-I13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C42558 [cLEG-60-J9] Trace: SGN-T77160 EST: SGN-E263751 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551150Length: 648 bp (798 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551150 [] (trimmed) CAGGTTACTCTCTTGCTTGAGTCTGGAGTTGACATCAATCTCAGAAACTACCGTGGACAGACTGCTTTGATGCAAGCATGTCAGTATGGTCACTG
GGAAGTCGTTCAGATTCTCATTCTTTTCATGGCCAATATTCATAAGGCTGATTATCTCAACGGGGGTACATCACTTCATTTAGCTGCTCTAAATG
GACATTCTCGATGTATACGGCTTCTCCTTGCTGATTATATTCCCAGCATCCCTAATTTCTGCAATGTCATGAGAAAGAGATCAAAAAACGAAGAC
TCTATCCAAGAATTCGATGACTTTGCACTACATGAGGTGATCAATAGACCTGCTGATGGTGGCATTACCGCCCTTCATATGGCAGCGCTGAATGG
CCATGTGGAAAGTCTGCAACTACTCTTGGATTTGGGGGCTTCGGTCACCAAGGTTACTGTGGAGGATGGGACTACAATTGATTTGATAGGTGCAG
GAAGTACACCACTTCATTATGCTGCATGTGGTGGGAATGCTCAGTGTTGCCCGGTGTTGTTCCTCTTCTGTTTGCTTTTCTTTCTGATTTTTCTG
GTATAGTCGGTGCAAGTTCTGAAGTCATCATTTTATATCCTATCTTTCAGCTTTTAATTGCCAGGGGTGCCAGTCTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551150] SGN-U569621 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352025 [Download] [View] Facility Assigned ID: TUS55I13_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5