EST details — SGN-E551286

Search information 
Request: 551286Match: SGN-E551286
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186567Clone name: TUS-50-F5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C4162 [cLEC-23-M10] Trace: SGN-T28433 EST: SGN-E206474 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551286Length: 638 bp (770 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551286 [] (trimmed) CCCCCACAAACTACCACTGGGGGTGTTATGTCCATTCCTCTCCAGCCCCACAAAAATTCAGACACCAAAAGAGAGGAGGTGGAGGGACCTCTTCT
GTATTTTTTGCTTAAAACTAAATAAACTAACAGGTGCCATTGAAGTTGACATTGTTGCGTTTTGATGCAGCCATTGTGCTGCAACCAGAATCACG
TGCCCTCTTCTTTGCAGTTGGAGTTTCATCACCCATCATCTTTGCTAAATCTCTACCAAACATATCCACAAACGTCTTCTGCAAATCCTCTAGAC
TCTCCTCCTTCACCATTTTTAATTACACAATAAATAAGCACATCATTTCAAAAATGAATCATACACGCACAAAAATCATGTAGGAGTAGAACTCA
TCAAAATATCTTACCGCTGCTCCAACATTTTGATCCATTCGGTTTATCAAATCATGCAGGAAATCACCCATTCCCTGCATACAGATAAATTGTAT
TAGTGTTCTATTATTACCTAAACGTTGATAATTGAAAGCTAAAACTCGCAAAAATGTAATAGTTGAATTTTTTTTAATAAATGGGGATGAGTGAC
AGAATATGACACAACTTCGGGTTTCTGAGAACATAACCATAAGAAGGAGTGGAAGACAGGTCGAAAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551286] SGN-U575112 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352161 [Download] [View] Facility Assigned ID: TUS50F5_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0036 Quality Trim Threshold: 20.5