Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E551295

Search information 
Request: 551295Match: SGN-E551295
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186694Clone name: TUS-50-K12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C8523 [cLEC-52-C4] Trace: SGN-T32536 EST: SGN-E209727 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551295Length: 595 bp (723 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551295 [] (trimmed) CAGATATTTTTGAATATTACAACTTTACTTTCTCCATATAAATCCTTACCCAACCATTCTTCCATTTCCATATCCAAATCCAAAAAAACTCTCTT
TTTTTATTCCATACCAACAACAACATAGATATCGATTATCGATCATCGAATCAAAGTATTTTTATTTAACTTACAACGATAAATGAAGATTGGAT
GGGAATCACTTGTTCCTAGCTGTATTAAATCACATGAAAATTCGAAAAAAAATCCAAAAATGGTAAAAGTGTCCGTTACAAAACAAATCTCTTTT
CATGGGATACCTGTATCGGATCTTAGTTCATCCACCATATCCTCAGATCTTTCTATCTCCCTTGCTGGTTCAAATATTCATGCCTTTACACAACA
AGAACTTAGAGTGATCACACAAAACTTCTCCACGAGTAATTTCATTGGTGAAGGAGGGTTTGGGCCAGTTCACAAAGGATTCATTGATGATAAAC
TTAGACCTAATGCTATTAAAGCTCAGCCTGTTGCTGTTAAAAACCTCGATTTAGATGGTTCACAAGGTCATAGAGAATGGCTGACAGAAGTGATA
TTTCTTGGACAATTGAGGCATCCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551295] SGN-U583550 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352170 [Download] [View] Facility Assigned ID: TUS50K12_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5