EST details — SGN-E551361

Search information 
Request: 551361Match: SGN-E551361
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188478Clone name: TUS-55-E20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C41078 [cLEG-56-A3] Trace: SGN-T75828 EST: SGN-E262356 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551361Length: 642 bp (859 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551361 [] (trimmed) AAATTCGATCTTCAGAGTACTGAATCATCACAAAGGAAGATTCTACGATAAGGGTTGTTCAGATCGGTGTTTGTAAAACATCTGTTCTATTTTCT
TATAGAAACTAAACATGCCTAAGGAGAGAAGAGATAGGTCTGTTTCTTTTGATAGGAGCAGAGCTTCTCCTTACTGTTGTAGCTCGAGTCACTCA
AGGTCATCATTGTCCAAAAACCCTTTGGAAAATGAGGAAAATGTGAAGGACTGGGAAGATGCTCGATGCCCAGTGTGTATGGAACATCCTCATAA
TGCTATTCTCCTTCTGTGTGCCTCTCATGAGAAGGGCTGTCGTCCTTTTATGTGTGACACAAGTTATAGGCATTCAAATTGTTTTGATCAGTTCA
AAAAGTCATTTGAAGAAGCTTCAGCATCAACAACTCAGCAAGTGGAGATTCCAGCTTCAGCTTCTATTACGGAATCTACTGTAACGTTATCAGAA
GCTCTGTCTGAACTTCCAGGTGAAAGGACCGAAGGTGGTTCTATATCCCTAGATGCCTTGTCTTGCGAGAACCATGAAATAAAGAAGATGCTATG
CCCTCTCTGCCGTGGCCAGATAAATGATTGGATTGTTGTAGACTCTGCCCGTCGTCACATGAATGCCAAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551361] SGN-U569293 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352236 [Download] [View] Facility Assigned ID: TUS55E20_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5