Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E551408

Search information 
Request: 551408Match: SGN-E551408
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186449Clone name: TUS-50-A7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3244 [cLEC-1-M9] Trace: SGN-T24634 EST: SGN-E200421 Direction: 5' Facility: TIGR
Clone: SGN-C3244 [cLEC-1-M9] Trace: SGN-T24635 EST: SGN-E200422 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551408Length: 579 bp (732 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E551408 [] (trimmed) TTGCCCCCCCTCATACGCTCTTGGGGCTCTTTTAACACCCTTGAAACCCCCACAAAGCCCATTCTGCGGCTTTTAATCGGCTAATGATACCCTTC
ACGCTGCCGGAAAAGTTGACGGCGTTGCTGCCAGAAAAGGTGTCAGATCTGTCACAGAAGGCAAGCCCTTTTTTTTTCATATTACTAGCTCCGTC
TATTTTAACGTGTCTGTTTGGACTTCCATTGTATTTTAGTGCTGATGATTGAACTTTATAACTTCAACTTAAAATTAAGTGTCTGTAAGTATACT
TAAAAACACTTAAAATAATTAAAACTCAAAACAGATTCATAAATTATAGTAAATCAATTTTATGATTACTTTTGACATGTTTTTATTATTTTAGC
TTCAAATGAAGTGCGTATAAGTACTTTTTGAATTTATTCAAAAACTTCAAAAGGAATTATTTTAAATAAGTCTACTGTTTTTTAAGTTTATTTTA
GGTAAAACAATTAAGAAAATTTATTTATCTTTTTTGATTTTCTTGAGAAATTCACTGTTTTGTCTATCTTTGATGATATTGAATGTGTCATTCAN
GTGCTGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551408] SGN-U577389 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352283 [Download] [View] Facility Assigned ID: TUS50A7_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0154 Quality Trim Threshold: 20.5