EST details — SGN-E551410

Search information 
Request: 551410Match: SGN-E551410
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186509Clone name: TUS-50-C19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2251 [cLEC-15-F16] Trace: SGN-T26664 EST: SGN-E203563 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551410Length: 622 bp (752 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551410 [] (trimmed) GCAGTGCTGGACAAATGCAGTATGCTATAAGGGTATTTGAAAGGATGTGCAAAATGGATGTATCTCCTAACTTGAAAACATTTGAGACCCTCATA
TGGGGTTATGGAGAAGCAAAACAACCATGGAAGGCTGAAGAGTTCCTCCAAGTTATGGACGAGATGGGAGTAACTCCCACGAAGAATACTCTTCA
ACTTGTTTCAGATGCTTGGCGAGCAATTGGTTTCCTTAACGAGGCCAAGAAAATCTCAGGGGATGTGGAATATGATGATAGCACATTCTTGAATG
CTCTGGAGGACAACAACTTTGAACGAGTAGTTTATGCTAAGGATTCTCTCTCAAGCCTTAAGCAAGTAAGCAACCAAAATGGGTCGAGCCCTGTC
AATAAAAGAAGCCAAATAGTGCTGAGCAGATACTGTTGTTTGGGCGGAAGCATAAATGTGGCAACTAAATCAATAATGCTTCCCCATACTTGTCG
ATTCAACGTAAAATCTTTGATGATATTTGACAAGCAACGTCAAGTGAAGATCGGAATATATGGTTTTGTGAATTCATGTAGAATAATGGCCTTAA
ATTAACAAACTTCCAGTTCAGTCCATTAAGGAAAGCCTCTTGAAATCACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551410] SGN-U571930 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352285 [Download] [View] Facility Assigned ID: TUS50C19_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5