EST details — SGN-E551503

Search information 
Request: 551503Match: SGN-E551503
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C171576Clone name: TUS-11-E14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C61639 [cLEM-18-P9] Trace: SGN-T86127 EST: SGN-E269331 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E551503Length: 613 bp (837 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E551503 [] (trimmed) CTTAAACCCCCCCAAAAACCATATGTCGGCCTTTATAAACAATTAATTCACCCAATGCACCACTATGGATATCCAAAAATACTGTGACTTACAAT
TCTCTTGGGGGAGGACTTTGTATGACGGGAAACCTGAACAAGAGCCTGCAATTTGTCCAAAAGTTCATTCAGAAAGGGTTGGTACCAAATGCATA
TACGTACTCTATATTGCTTGAGGCTAGTTATAAAGAAAAAGGGGTTAATGAAGCAATGTTACTTTTAGACAATATTATTGCCAAGGGTGGAAAGC
CTAATTTGGTTAGTTACAATGTTCTCTTAACTGGGCTGTGCGGAGAAGGAAGAATAGATGAAGCTAAACAATTCTTTAGAAACTTGCCATCAAAA
GGGTTTAATCCTAACGTTGTCAGCTATAATATCTTGTTGAGGAGCTTGTGTTTTGAAGGACGTTGGGAGGAAGCCAATGAGTTTCTGGCAGAGAT
GGTTGGAGAAGATCGTTCTCCATCGATTGTAACGTACAATATATTGATCAGTTCGCTTGCTCTTCATGGGCAAACGGATCATGCTATCAAGATTC
TGGATGAAATGTACTTTGCAGAACAGTTCAAGCCAATTGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E551503] SGN-U567406 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352378 [Download] [View] Facility Assigned ID: TUS11E14_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0088 Quality Trim Threshold: 20.5