EST details — SGN-E552377

Search information 
Request: 552377Match: SGN-E552377
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C331157Clone name: cTSB-3-L20
nocartOrdering Not Available
Library Name: cTSBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E552377Length: 248 bp (1211 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E552377 [] (trimmed) GATTTGGAGCCGATCTATACTTTTGAAGGTACTTACTATATCAACACGTTGGTAACGGGTAGAGAAATTACTGGTTGTGGCTAGTTTCAAGCATG
CACCAGTAAGGCAAAAGAGTCGCCTGTGAAAAATTTCATCTTCTCCTCTGGGTAGTAAGTATTCTGCTGAATAATGTTCTGTTTAAGCAATTGTA
ACTCTAGAATACTTCTTGTAGATTAATAAATATCATACTTTAATTTATCGATCAACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E552377] SGN-U584054 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T354928 [Download] [View] Facility Assigned ID: ctsb3l20
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.899 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5