EST details — SGN-E552415

Search information 
Request: 552415Match: SGN-E552415
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C331203Clone name: cTSB-3-N19
nocartOrdering Not Available
Library Name: cTSBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E552415Length: 352 bp (1189 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E552415 [] (trimmed) GAGCTGTTCTTTCAGATGGTTTTCGAAAAAATCCAGTCTATAGTGAATGCAACCATATTGGAATTGTTCTGTCCGGAGGAAACGTTGATCTTGGT
GTGCTCTGGAATTCCTTTGATAAATGAGAAACTCTATTAGTCGCGAGAGGCAGATTCAGAATTTAAATTAGTAGTTAGAGTTTGGAATTTTGCCA
TAACTCATTTGATTTACTGGGTTCTGAATCAATTACCATTTGTTCTTCTTTAGTTGTGTTTTTTTATTATATACATTGTTCAATCCAAAGTTACT
TGTTTCAGATGAATCCGTAACTTTCACTCTATGTCCATCCTTGGAAACAGATGTTATTCAATGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E552415] SGN-U572073 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T354974 [Download] [View] Facility Assigned ID: ctsb3n19
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5