EST details — SGN-E552609

Search information 
Request: 552609Match: SGN-E552609
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C331436Clone name: cTSB-4-H2
nocartOrdering Not Available
Library Name: cTSBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E552609Length: 583 bp (1203 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E552609 [] (trimmed) CAGAAACTGGCGCTGCACCACCGGCGACAGAAATTGGTGCTACACCACCCGTGATAGAATCTGGTGCTGCATCCGCAACAGAAACCGGTGCCACT
CCTGCAGAATCAAGTACAACCCAAACATCAAACTTGGATTCTTCAGTTGCTGCTGATGCAGTTGTGCCTGCTACACCAGCATTGAATGAATCAGA
CTATCTAGCGTTGGTCCCATCAACATCAGCTCCTGCAGAACCAACTACAATTGGCGCAATTGTTCCATCCACAGGTCCACCACCTGCCACCGATA
ACAAGAAACCAAGTGTTCCTGGTGAACGTCTAATGATTGATTTTTCTTGACGTTCCCTTACAGCACCCTCACCTTTCCATGCAGATTCTCTGTCG
TACGAGTGGTATGGATTTCTTGCATTACATTTCTAATTGTGGAGTAGATATATATTTATACTCGTTTATATGCTTTAAGTACTACACATGCTGCG
GTTGAATCTGTGAGTTGATAGGATTGTTAGATTATAGTAGGTGTTAGGTTTGTTTTGTTAATATCACTTTGTCCTGTCTGATCCTTATTCTTTGA
TTTGGTGGAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E552609] SGN-U573888 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T355207 [Download] [View] Facility Assigned ID: ctsb4h2
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0031 Quality Trim Threshold: 20.5