EST details — SGN-E553118

Search information 
Request: 553118Match: SGN-E553118
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C330296Clone name: cTSB-1-G9
nocartOrdering Not Available
Library Name: cTSBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E553118Length: 297 bp (1229 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E553118 [] (trimmed) ATATTGAAATTTGGTTGGGTTTATTGGGTTTTTTAGTTGAGTATTTTATTTACGGCTACTATTATTATTACTAAAACTATATTTTAATATAATAT
GGTTACAATGAGGGCATATGTTAATATTAATATATGCCTAGGTCTAGGGGGCCGGGTGGAATATTTTACATAGTTTTTTTTTAAAGCTATGTGTG
TAATCTTGTCCAGGGTTCATTTTGTCATGGTTTGATTAAAGATGATATGAAATTTGATCCCTAGTTTATTATAAAAATAAAGGGGTAATAACTTT
TTTTTGTTGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E553118] SGN-U579178 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T354067 [Download] [View] Facility Assigned ID: ctsb1g9
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.879 Expected Error Rate: 0.0145 Quality Trim Threshold: 14.5