EST details — SGN-E553691

Search information 
Request: 553691Match: SGN-E553691
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C332358Clone name: cTSC-1-O22
nocartOrdering Not Available
Library Name: cTSCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E553691Length: 859 bp (1257 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E553691 [] (trimmed) GGCAATTTCCATTACAGCCGCTAGGTTTCCGTCCACTTCTTCTTCTCCATTAATATCTGTATGGTGTTCTTCTTTTTTGAATTCTAGATTTTTTC
TTTGAATTCTTGTTAATCTTTAATTTTCTTTGTTTAAATCAAGAAATTAGCTTCTTCTGAAGTCAGGGTGGGGATTTTTGGATCGTGTCAAAGTG
TGTTAGAGGGTGATTATCTTTTGATTCACTTGTTTTTTTTGCTTCTTTTGAGGGGGTAGCCGGGGCCTCGGCCTCGGCGGGTTTTAATAGCCCCC
AACTATTACAACATTGGGAAGAAGAACATCAATCTGTACAAACCCTTAAGTTAGTTTTTCTTTTTAATTCTTTGATTCTTTCTTCTTAACAAATC
AAAACAGATCGGGGAAGAGATGCCGGCCTTAGGTTGTTGTGTAGACGCTTCTGTTTCCCCTCCTCTCGGCTATGCCTTTTCTTGGGATAGCTCTC
TTCCCGCGCCGGAGTTGTTTTCCTCCGGCGTACCTCCGGCGACAAACGCCGCCGCCGTTTCCACCGGTTCTCATTGGTCTACGGATCTGTCATCT
GATTTGTACCGGGTAGATGGGTGGGGTGCTCCTTATTTCTCCGTGAACTCTTCCGGGGATATTTCCGTCCGTCCACATGGTACGGATACTCTTCC
TCACCAGGAGATTGACCTTCTTAAGGTTGTGAAGAAGGCTTCTGACCCGAAAAATTTGGGTGGACTTTGGCTCCAGATGCCTCTTGTTGTCCGTT
TTCCTGATGTTCTGAAAAACCGTTTGGAGACTCTGCAAATCGGCTTTTGACATGGCGATTAATTCTCTAGGGTTATTAGGCTCACTATCAAGGGG
GTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E553691] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T356129 [Download] [View] Facility Assigned ID: ctsc1o22
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0089 Quality Trim Threshold: 14.5