Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E553806

Search information 
Request: 553806Match: SGN-E553806
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C332496Clone name: cTSC-2-E23
nocartOrdering Not Available
Library Name: cTSCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E553806Length: 763 bp (1146 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E553806 [] (trimmed) GCAAGAGTGAAGAATTTGCCGACATGGCCTCAGGTTGTGCTTCATCCACCATTGCTGCTGTTGCTTTTTCTTCTCCAAGTTCGAGGAGAAATGGA
TCAATTGTAGGAACAACAAAAGCTTCATTCCTTGGAGGAAGAAGATTGAGAGTAAGCAAATACAGTACTACACCTACAGCACGAAGTGCAACTAC
AGTGTGCGTTGCTGCAGACCCTGACAGACCCCTCTGGTTCCCTGGCAGCACCCCACCTCCATGGCTTGATGGCAGCCTTCCCGGAGACTTCGGTT
TCGATCCTCTTGGTCTAGCATCTGATCCAGAGAGCTTGAGATGGAACCAACAGGCAGAACTTGTACACTGCAGATGGGCAATGTTGGGAGCTGCA
GGAATTTTCATTCCAGAATTACTCACAAAAATTGGAATACTTAACACACCTTCATGGTACACTGCTGGTGAACAAGAATATTTCACGGACACAAC
GACTCTCTTCATCGTTGAATTGGTACTTATTGGTTGGGCTGAGGGAAGAAGATGGGCAGATATCATCAAGCCTGGATGCGTTAACACGGATCCAA
TCTTCCCTAACAACAAGCTCACGGGGACAGATGTTGGTTATCCAGGAGGTTTATGGTTTGATCCCTTGGGTTGGGGTTCGGGTTCACCTGCAAAG
ATAAAGGAGTTGAGGACAAAGGAGATTAAGAACGGTAGAATTGCTATGTTAGCCGTTATGGGTGCATGGTTCCAACACATTTACACTGGAACAGG
CCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E553806] SGN-U579101 Tomato 200607 Build 2 271 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T356267 [Download] [View] Facility Assigned ID: ctsc2e23
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5