EST details — SGN-E553846

Search information 
Request: 553846Match: SGN-E553846
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C332544Clone name: cTSC-2-G23
nocartOrdering Not Available
Library Name: cTSCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E553846Length: 810 bp (1146 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E553846 [] (trimmed) GTAAAGAAGAAAAAAAATGATGGGTTCCAAGGAATTTCTATTTCTTGGCATTCTTTTGGCTATTTTTGCAATGATAAGCTGTGAGACCTCAATGA
AATTGGATGACAAGAATGATGAATACCATGATGGATATAATGGCATTGGCGGATATTCTGGTGATGGACGTGGCAAATATAATACTGGATATAAC
TCTCCACGTGATAAATATAAGTACCCTAGTGAAGAATATAAGTCTCCAGGTGACAAATATAGATCCCCATATGACAAATACAAACCTCCTAGTGA
TGAGTACAAATATTCACGTGACAAATATAACTTCCCACATGATAAATATAAGGCTCCTAGAGATGAATATAAACATGCAGGTGACAACTATAATC
CCTCACGTGATAAATATAAGCCCCCAAGTGAGGAATACAAGTCTCCAGGTGACAAATACAAATCTCCAGGTGACAAATATAGATCCCCATATGAT
AAGTACAAACCCCCTAGTGATGAGTACAAATATCCACGTGACAAATATAAGCCCCCTAATGACAAATACAAGCCTTGAAGTGGTGCATACAACCC
TCCCATTGGTGGCCATGAGTAAGTGACTAGCCAATTGTCTCAGAACAAATCATCAAATAATATTATAAATCGTTGTATGTAGTGGCAAGATGTAT
GATATAGTAATGGTCTTGCTACTCTAAAATCGTATGAATAAAACATCATTCAGTTCATATGTATGGTTGATCATGTAATATTTTGTTGTAAAAAT
GTAACACAATATACTGTGATAATATATTTTCAATTTTTCCATAATGTNTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E553846] SGN-U593150 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T356315 [Download] [View] Facility Assigned ID: ctsc2g23
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5