Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E554496

Search information 
Request: 554496Match: SGN-E554496
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C333324Clone name: cTSC-4-H5
nocartOrdering Not Available
Library Name: cTSCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E554496Length: 802 bp (1228 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E554496 [] (trimmed) GAATAGTTATATGATGCATGTATTGTTTAATAGCATACTTGAGCATGTCACAAATCTCATTACATTAGGAGGATCCACAGAAAAGAGTTCAGCAC
ATTGAAGATGTTTTCATGAAATCTGTACAGTGATGGACCATGAGCACAACGAACTCTAATAATCAGCACAAACAAATTAAGCAAAAACAACATTG
AGATGAAAAGCACCAGCAGAGATTTAAGAGCAACAAGAAGCACTAGCCGGTGTTTGAGCAGGCCTATCCATAAGAACCATCCCAGATGGATTTTG
TGCTGGCTGAAGTCGAGGCAGTCTCTTTGCTATTTCAGAGAAAACATCATTAACATTAGATGCAGTTTTTGCAGATGTTTCCATGAAGAACAGAC
CATTCTCCTCCGCATATGTTTGTGCTTCCTCAGCAGCCACTTTTCTTGCATCTAACAAATCTGCCTTATTTCCGGCTAGTGCCATCACCATATTC
GGATTACCTTGTGCTTGAAGTTCCTGAACCCATTTTTTTGCTCTATCAAATGATGCTTGATTTGTTATATCATAAACAATAATAGCAGCTGCAGC
ACCTCTGTAATACATTGGAGCTAGACTGTGGTATCTCTCTTGGCCTGCTGTATCCCATATTTCAAATTTTACAGTTGCATCATTTACTGCTACTG
TTTGAGAGAAAAATGCAGCACCTATGGTTGATTCCTGAAATTCAATAAATTGTCCTTTAACAAAACGCAGAACTAGACTAGATTTTCCAGCTCCA
ACATCCCCAAGGAGCACCAATTTGGCGTTCATATTCTTGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E554496] SGN-U565736 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T357095 [Download] [View] Facility Assigned ID: ctsc4h5
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0041 Quality Trim Threshold: 12.5