EST details — SGN-E554819

Search information 
Request: 554819Match: SGN-E554819
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C333712Clone name: cTSC-5-I16
nocartOrdering Not Available
Library Name: cTSCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E554819Length: 626 bp (1345 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E554819 [] (trimmed) TATGTTATGATGATGACAAAACTATATTTGCTCTCTGACCATGGATTCATGTCACTTGCAACGGAAATAATCAAGTTACTCGTGTGGATCTTGGG
AACTCAAAGTTATCTGGTCATTTGGTACCTGAGCTTGGAAAGCTTGAACATCTACAGTATCTGGAGCTTTACAAAAATAATATTCAGGGAACCAT
CCCTAAGGAGCTCGGTAACTTGAAGAGCCTTATTAGTCTGGATCTGTACAACAACAATATTTCGGGGACAATTCCTACTTCACTTGGAAACCTGA
AAAACCTTGTTTTCTTGCGTCTAAATGATAACAAGCTAACAGGACCAATCCCAAGAGAACTTACTAGCATTTCTAGCCTGAAAGTTGTGGATGTC
TCGAATAATGATTTGTGTGGAACAATTCCTACTTCTGGTCCATTTGAGCATATTCCTCTAAACAATTTCGAGCACAATCCTCGACTTGAAGGTCC
GGAGTTGTTGGGACTCGCTACCTACGACACCAACTGCTCTTAGAAGCTTGATGAATAGCTTCAGAAGAAGCACCACTTTTGTGGACGTTTAACAA
ATTCCCCTGAACCTTTGTTATTGGTGTACTTTCAGTGTGTCCAAAGTTGTAACTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E554819] SGN-U583216 Tomato 200607 Build 2 165 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T357483 [Download] [View] Facility Assigned ID: ctsc5i16
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0258 Quality Trim Threshold: 14.5