EST details — SGN-E555950

Search information 
Request: 555950Match: SGN-E555950
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328978Clone name: cTSD-1-O4
nocartOrdering Not Available
Library Name: cTSDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E555950Length: 882 bp (1279 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E555950 [] (trimmed) GTGAAAGATTATGGCGGTAAAGGACAAAAAGCCATCAGTAGAGATCAACAATCTCAAGTTCACCTATCCTGGTATAGATGGACATCCGCCTCCCG
GATCTACCCCTTTGATAGATGATTTCAACCTTACCCTTTATCCTGGTGATCGATGCCTTCTTGTCGGATCTAATGGCGCAGGTTCTAATTCTATT
TCCATTCCACACATTGAAAATCTGAATTACTCTCTTTAGTATAATCAAGAATTCTAAAGGGGTTGTATTAAACTTGTTTCTCGATCCTGCTATCC
CCAATTCCGAATTTTTAGGGTGCCTTTTGGTGTTGACGAAATTGTCTTTTCGTGGAAAAGAAGTTGTTTTCTTAATGATGTTTCCACCATTTGAT
AAGATATAGAAGGTGTGCTAACCCAGGGTAATTGTATAATGTACAAGATAAGGTACAAGGATAGTGTTTTGACATATTCTTTTTTAGTGTTAAAG
GTTGACAACAATGTTTAGATGTCTGTTGTGGTGAGTAAGAATTGTCATATTTGTACAGAAAAATGACTTGCCTTCATAAAGGGAGAGGATGCCAT
CTTGCTTATTTTGCTAGAAAATTGTAGAAAACATAGCCAACCAAACACTGTATATACATTTTTTGCCCTACCAAAGGCATTCCCTTAATAAGAGG
TTTGATTGAGATCTGAGAGACATGTTCTTTTGATAGGGAAGACTACAATCCTGAAGATATTGGGAGGAAAGCATATGGTAGAACCAGACATGGTC
AGAGTCCTTGGAAGATCTGCATTTCATGACACTGCTTTGACGGCTTCTGGAGACCTCAGTTATCTTGGTGGAGAGGTGTCTCTTCTCTTGCTTTG
CTCCTTCACTATCTCTTCATAGNTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E555950] SGN-U595947 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T352749 [Download] [View] Facility Assigned ID: ctsd1o4
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5