EST details — SGN-E556220
| Search information |
| Request: 556220 | Match: SGN-E556220 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C329302 | Clone name: cTSD-2-M21 |
| ||
| Library Name: cTSD | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: seed
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E556220 | Length: 144 bp (1070 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E556220 [] (trimmed)
ACATTTATATGGGTTTTAGCAGTTAGTTTTACCATTTTCATGTAGGAGTTTGAACCGTAAGGGAGCTATTTTGTTACTTTCTTTTATGTCATTTA
CAAAAACAAAAATCTTGCCCTTTGGGTTTTCTTAAGGGTTTCTCTTAAA
CAAAAACAAAAATCTTGCCCTTTGGGTTTTCTTAAGGGTTTCTCTTAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E556220] | SGN-U583189 | Tomato 200607 | Build 2 | 28 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T353073 [Download] [View] | Facility Assigned ID: ctsd2m21 |
| Submitter: Koni | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.888 | Expected Error Rate: 0.0061 | Quality Trim Threshold: 12.5 |
Working
