EST details — SGN-E556736

Search information 
Request: 556736Match: SGN-E556736
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C329921Clone name: cTSD-4-H1
nocartOrdering Not Available
Library Name: cTSDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seed
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E556736Length: 865 bp (1252 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E556736 [] (trimmed) GAGTTCGGGTCGAGGATTTTTCAGTGGCGGGGCTCTAAAAGTGAAATTCTCTCACAGATCTCTCTCCTTTTTACGAGAAAACCCTAGCTTTATCT
CTCTTTCTTTCACCTTTAAGCGTCCTTTTTGTTGCCTATTCATTCGTACTCCAGTTTTAATCAATTGGGATTTTTTTTACCGATCTGTTTAGAAA
ATGGCGAAAGGGACCACAGGACGACGTAGGAATGGTTCTCGACGATGCAGGGCCACCCCATACCCTTTGCCATCTGCTGACCATTCTGAACTTGT
TCACCAAAAGAAATGCTCTAAAATCTTTGAGAAGAAAGACTGGGAAGATGCAACATGTTCTGTATGCATGGAATATCCCCATAATGCTGTGCTTC
TCCTGTGTTCCTCTCATGACAAAGGTTGCCGCCCCTACATGTGTGGAACTAGCTTGCGCTATTCAAACTGCCTCGATCAGTACAAGAAAGCCTAC
ACTAAAGCAATACTGCCAGATAATAATCAACCCGTGCAGGGTGCTACTGATCCTCCAACTGCTGAACCATTTTCTACTTGGCCTTCTGAGAAAAG
CGAGGTCTCAGAAGTTGCTTGCCCACTATGTAGAGGCCAGGTGAAGGGATGGACTGTGGTTGAACCTGCAAGAGAGTATCTAAATTTGAAGAAGC
GTAGCTGCATGCAGGATGATTGCTCGTTTGTTGGAAGCTACAAGGAGATACGAAAACATGTTAAGGCAGAGCACCCCTGTGCTAGACCACGTGAA
GTAGATCCTCTTCTTGAACAAAAATGGACAAAGCTTGAGAGGGAACGAAAGAGGGATGATGTTATCAGCACTATAACTTCTTCTATGCCAGGGGC
TGGGGTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E556736] SGN-U581362 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T353692 [Download] [View] Facility Assigned ID: ctsd4h1
Submitter: Koni Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0018 Quality Trim Threshold: 20.5