EST details — SGN-E558202

Search information 
Request: 558202Match: SGN-E558202
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C335727Clone name: 17506
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E558202Length: 244 bp (339 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E558202 [] (trimmed) CTGGTACTCTCAAGCTGACTGTGCTGTCCTCATCATTGACTCCACAACTGGTGGTTTTGAAGCTGGTATTTCCAAGGCATGGACAGACCCGTGAG
CATGCATTGCTTGCTTTCACCCTTGGTGTCAAGCAAATGATTTGCTGCTGTAACAAGATGGATGCTACCACTCCTAAGTACTCCAAGGCTAGGTA
TGATGAAATCGTGAAGGAAGTTTCTTCCTACCTCAAGAAGGTAGGATACAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E558202] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T359608 [Download][View] Facility Assigned ID: bf_swstxxxx_0017e09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0091 Quality Trim Threshold: 14.5