EST details — SGN-E558695

Search information 
Request: 558695Match: SGN-E558695
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C336285Clone name: 18075
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E558695Length: 351 bp (828 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E558695 [] (trimmed) AACAACTTTTAGCTGAAATATAATTCTCTCTGCAATTTTTCTGTTCTCATATATCGGCGGGCACCACATTTTCCTTCAAAAATGACTACATCAAG
GCGTCTTGGCTGATAGGAAGGTGGANAGGTTTGAGAAAAATATTACCAAGCGAGGAGCTGTTCCTGAAACTACTGCAAAGAAGGGAAGCCAGTAT
CCAGTTGGCCCTATCTTGCTTGGGTTCTTCGTCTTTGTTGTCATTGGCTCATCTTTGTTCCAGATAATAAGGACAGCAACCAGCGGCGGGGGTAT
GGCTTAAGCCTGCACAGTTATACAAGTAGTAGCGCCTGCGTTGTTGTAGTAGTGTTGTTTTCCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E558695] SGN-U270340 Solanum tuberosum Build 4 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T360172 [Download][View] Facility Assigned ID: bf_swstxxxx_0023e05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0306 Quality Trim Threshold: 14.5