Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E559530

Search information 
Request: 559530Match: SGN-E559530
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C337231Clone name: 19042
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E559530Length: 654 bp (744 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E559530 [] (trimmed) TCGGCACGAGGGCAGCATGTCTCAAACGGAATTATTTCCAGGAAGCAATCAAGCAATGTCCAAGGTCTTAGAAGTTGAGTCCTGCAATGTGAAAG
CATTATATAGGAGAGCACAAGCATTTATGGAAACAGCTGATCTGCACTTGGCGGAATTGGATATCAAGAAGGCACTAGAAATAGATCCACAAAAC
AGGGAGGTGAAACTGATACAGAAGAACCTAAAACAACTCCAAGCAGAGAGCAACAAGAGAGACGCAAAGCTCTATACAACAATGTTTGCACGCTT
GTCAAATGAGAACTCTTCTGCAGCAAAGAGATTAAAAGTTGAAGAAACGGAGAACAAGAATGAAGAAAATGTTGGTGAAATCAACATGCGCTGAC
ATTTGATTGGAAGTTGAATCTAGATGAAGAATTGTACTTGTATACATATTTTCTAAAGCTAACAGAGTCTTGAGCCAGGAGTCTATAGGAAACAA
NCTCTTTACCCCACTTACCCTGCAAAGGTAGGGGTAAGGTCTGCATACACCCCACCCTTTCTAGACCCCACTTGTTTCAGGAATATATTGGGTAT
GTTGTTGTTAACACCGAGCATGTATAGACAAGGTAATAGAGAAAGGCCTTACATCGCAGAAACCACACTTGTACCTCTGGAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E559530] SGN-U283893 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T361096 [Download][View] Facility Assigned ID: bf_swstxxxx_0033f03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0039 Quality Trim Threshold: 20.5