EST details — SGN-E559839

Search information 
Request: 559839Match: SGN-E559839
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C337581Clone name: 19398
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E559839Length: 574 bp (837 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E559839 [] (trimmed) ATCTGCAAANCCCAAAAAAAAAACTCATTTTCTCATCTGATCAAATATGGCAGGAATCATCCACAAAATTGAGGAGAAACTCCACATCGGAGGAG
GCCACAAGGAAGAAGAACACAAAAAGGAGGAACACAAGGGAGAAGGACACAAGAAGGAGGAGCACAAGGAAGGATTTGTTGAGAAGATAAAAGAT
AAGATCCATGGAGAAGAAAGTGGAGAGCATCACAAAGATGGAAAAGAGAAGAAGAAGAAGAAAGACAAAAAGGAGAAGAAGGAGAAAAAGCATGA
TGGACATGATAGTAGCAGCAGCAGCGACAGTGATTAGATCTGATCTCATCGCATCTGAACTTGATTGATTTCCTATTTACCTAACAACATTTCAT
CTATAGTATTTTTCTGCTATAGATCTATCTATCTATGTGAGAAAAAGAAAAAAAAAACAGAAAAAATGGAAAAGAAGATCTCGTGTTTATCTGCT
TTTGTTGTGATTTGTGAATGTACTCGTCTTTTGGACGGTTTGTGAATGTGATGATATTATAATAAATAATTTGACTTNTGTTTCGAACAACAAAA
AACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E559839] SGN-U269192 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T361446 [Download][View] Facility Assigned ID: bf_swstxxxx_0037c12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0083 Quality Trim Threshold: 12.5