Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E560322

Search information 
Request: 560322Match: SGN-E560322
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C338128Clone name: 19957
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E560322Length: 681 bp (735 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E560322 [] (trimmed) TCCTTTCTCTCTCTATCTTAAACTTTCTCTTTCTAGATCTGGGATCCCCAAATTTCTCCTCATTTTCTCTTTACCATTTCTCCTATTCTCATTTT
CATTCACCTTACTCCCTTTCCCCTCTTCTACAATTCTCTCTGAATTTTCCCTTTCGTAGAATTAGGGTTAGGGTTTCACCAAGAGAACAAAGATA
ACACCATTGGCATGTCTCGGTTTTCTTCTCTGCTGGGTTTTCATGCCATTCTGAAGAAACGACTCTGAAAGTAATTGGAGAGGTTAGAAGAAAAG
GAAACAAGAAGCTCCAAGATACCACATTTTAATCATTTTTTTTTAAAAAAATTCTGGCATCAGGTCTTCTCAAGAAGATCTGAAAAGAGGAGGGT
TGTTGTTGGTTTTCTGAATAGCCCGGAAAAATGAGTGCTTCAAGGTTTATCAAATGTGTTACCGTCGGCGATGGTGCCGTTGGAAAGACGTGTCT
CTTGATTTCTTACACCAGCAATACCTTCCCCACGGATTATGTGCCCACCGTGTTCGACAATTTCAGTGCAAATGTGGTCGTCAATGGGAGTACTG
TCAATCTAGGGTTGTGGGATACTGCTGGACAGGAGGATTACAATAGGTTAAGGACCTCTGAGTTACCGTGGAGCTGATGTTTCCATTTTTGGCAT
TCTCTCTCATTAGTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E560322] SGN-U273432 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T361993 [Download][View] Facility Assigned ID: bf_swstxxxx_0043b11.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0040 Quality Trim Threshold: 20.5