Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E560393

Search information 
Request: 560393Match: SGN-E560393
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C338209Clone name: 20040
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E560393Length: 670 bp (1033 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E560393 [] (trimmed) CATACGCGGCCAGGGTTTTAGCGAAGCTCTTTCTCTCATTTTTCCGTTTGTGAAAGTTTTTTAGACATCATGGGTAAAGAGAAGATTCATATCAG
CATTGTTGTCATTGGACATGTCGACTCTGGAAAGTCGACCACTACTGGTCACTTGATCTACAAACTTGGTGGTATTGACAAGCGTGTCATCGAGA
GGTTTGAGAAAGAAGCAGCTGAGATGAACAAGAGGTCCTTCAAGTATGCGTGGGTGCTTGACAAGCTTAAGGCTGAGCGTGAACGTGGTATTACT
ATTGATATTGCCTTGTGGAAGTTTGAGACCACAAAGTACTACTGCACTGTGATTGATGCCCCTGGACACAGGGATTTCATCAAGAACATGATTAC
TGGTACCTCTCAAGCTGACTGTGCTGTCCTCATCATTGACTCCACAACTGGTGGTTTTGAAGCTGGTATTTCCAAGGATGGACAGACCCGTGAGC
ATGCATTGCTTGCTTTCACCCTTGGTGTCAAGCAAATGATTTGCTGCTGTAACAAGATGGATGCTACCACTCCTAAGTACTCCAAGGCTAGTATG
ATGGAAATCGTGAAGGAAAGTTCTTCCTACCTCAAGGAAGGTAGGATACAAGCCGTGACAAAATCCCCTTTGTCCCCATCTCTGGTTTTGAAGGA
AGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E560393] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T362074 [Download][View] Facility Assigned ID: bf_swstxxxx_0044a12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5