EST details — SGN-E560625

Search information 
Request: 560625Match: SGN-E560625
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C338471Clone name: 20308
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E560625Length: 534 bp (650 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E560625 [] (trimmed) ATTTAAACTCAATAATGCAGGAGGTAAGAACAGTACGAGTAGGTAATGTATCAGATCTGGCAGCTGAGAGAGAGGTTCGCGAGTTCTTCTCGTTT
TCCGGCGAGATTGAGCATATTGAGATTCGCCGAGAACAAGGACAATCCAAGACTGCCTTTGTTACATTTAAAGATCCGAAAGCGCTTGAAATTGC
TTTGTTGTTGTCGGGAGCAACCATAGTGGATCAGATTGTAAATATTACTCAGGAAGAAGACTATGTTCCATCATCTGAGACTCGGGAAGTCAGGT
TAGTTGATAATGCCGTGAATGTTGCTGGAGAAAGTTCTTCTCCGCTTGCTGAGGCCAAACCTACTTCTCCTAGCAATGGAAGGGTGAACGGGAAA
GTATATATCAGTAAAGCCCAAGATGTTGTCTCAAATGTGTTGGCAAAAGGTTCAGCTATCAGACAAGATGCAATGAATAAAGCCAAGGCATTTGA
TGAGAAACATCAGCTAAGAGCCACTGCATCTGCCCGAGTCATTTCCTTTGACCGAAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E560625] SGN-U278784 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T362336 [Download][View] Facility Assigned ID: bf_swstxxxx_0046h04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5