Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E560728

Search information 
Request: 560728Match: SGN-E560728
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C338588Clone name: 20427
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E560728Length: 692 bp (827 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E560728 [] (trimmed) CTTCTAACTTAACCTTAACACTAATCAAGTTTCCAAAGCAGACCCTTGAGCTTTCTCTGAAAGCAAGCGAAGGGGGAAATGGGATTAGTGTTTTC
ACGATTGTTTTCTTCGTTATTTGGGAACAAGGAAGCTCGGATCTTAGTTCTTGGACTTGACAATGCTGGCAAAACAACAATTCTCTATCGTCTTC
AGATGGGTGAAGTAGTTTCCACTATTCCAACAATTGGATTTAATGTTGAGACGGTGCAGTATAACAATATAAAGTTTCAAGTTTGGGATCTAGGG
GGACAGACTAGTATCAGGCCATACTGGAGGTGCTATTTTCCTAATACTCAAGCTATAATCTACGTTGTCGACTCAAGTGACACTGATAGGCTCGT
GGTTGCTAACGAGGAGTTCCACGCCATATTGGAGGAGGAAGAGTTAAAGGGTGCTGTCGTCCTCATCTATGCTAACAAGCAGGATCTTCCTGGTG
CACTTGATGATGCTGCAGTGACTGAGGCCTTAGAGCTGCACAAGATTAAAAATAGGCAGTGGGCTATTTTTAAGACTTCTGCCATCAAAGGAGAA
GGGCTCTTTGAGGGCTTGGACTGGTTGAGTAATACACTCAAATCCGGAGGTGGCTAAATTTTTGTAAACGATGCAGCAGATAGACTGTGAAGACA
AACAAGAGAGAACTTGGTATTAATGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E560728] SGN-U272342 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T362453 [Download][View] Facility Assigned ID: bf_swstxxxx_0048b04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5