EST details — SGN-E561823

Search information 
Request: 561823Match: SGN-E561823
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C337678Clone name: 19497
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E561823Length: 281 bp (360 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E561823 [] (trimmed) GTTTTTTTTTTTTTTTTATTATTTTTCTTTGGTGACACAAGAGTATATTTATGATAAATATAAAATATATTACACATCTGGAATTGGTTTCCTGG
ACTTCACCATCCATCCAAGCATCAAAAACACAACACATACAGAAAAGAGGGGTCGGCGAGAAGTTTTTAGGAGCTGAGTTCAAGAAATCTTTGTG
CCATGGGATGTTTAGATTCAAAGAGTTCATCAGGCTTTAAAATTTCTACAATCTCTCCATTGACAAGCAGGCATACTATGTCAGCTATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E561823] SGN-U273212 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T361543 [Download][View] Facility Assigned ID: bf_swstxxxx_0038d03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5