Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E563024

Search information 
Request: 563024Match: SGN-E563024
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C339486Clone name: 1356
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E563024Length: 627 bp (1090 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E563024 [] (trimmed) GGTGCCAGACAAGACAGGTGATGAAAACTCTGACATGGACAGCGACAGCAGTGATAGTGATGAAGAAGAAGAAGCTGGATTGGGGACACCTGGTA
TTACAGTTACGCAAGGTGTTTCACGAAGGATGTGTTAATCGCATACGTGCTATGACACAAAACCCCCATATAGTTGCTTCTTGGGGTGATACTGG
TCATGTTCAGGTTTGGGATATTAGCTCTCATATAAATGCTTTGGCAGAATCAGAGAGTGATCTTAGCCACGGGGCTTCTGCAGTCTCTAATGAAG
CACCCTTATTTAAGTTTGGTGGACATAAAGATGAAGGCTATGCTATAGACTGGAGTCCTCGTGTTCCCGGGAAGCTTGTTTCAGGTGACTGCAGG
AATTGTATCCATTTGTGGGAGCCAACATCTGGTGCAACATGGAATGTTAGTGCTAAATCTTACATTGGACACACTGCAAGTGTTGAGGATCTCCA
GTGGAGCCCTACAGAAGATACTGTATTTGCTTCTTGGCTCAGTTGATAGAAATATTATAATATGGGACACCCGTATGGACAAACCTCTTGCAGCA
ACTATAACGGCCATAAAGGCAATGTCATGTGATATCCTTGCAACAAGTTGGCGAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E563024] SGN-U272014 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T363793 [Download][View] Facility Assigned ID: TBSK00927FF03T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5