EST details — SGN-E563134

Search information 
Request: 563134Match: SGN-E563134
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C339614Clone name: 1484
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E563134Length: 193 bp (273 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E563134 [] (trimmed) TTCCAGCTCAGGAAGCTTTATACGACTCGGTGCCATAACTATCCATGCACCAGGACCATGGTTCCTCCGCAAAATCATTCGTCAAGACATCTGCC
ACTGTGTAGAATCAACTGTTGTCGATGCCCAATCTCGGTCCATGCAGCTCTCCACTCGAAACATTAGTCTGGAGAAGTACATTGAAGTGGAGGAG
AAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E563134] SGN-U274084 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T363921 [Download][View] Facility Assigned ID: TBSK01062FA06T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5