EST details — SGN-E563143

Search information 
Request: 563143Match: SGN-E563143
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C339625Clone name: 1495
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E563143Length: 593 bp (886 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E563143 [] (trimmed) TGGATCCCCCGGCTGCAGCAAAAATTGTGGAAGTTGAGTTATTGAGATTTTTCTGTTTTTCTTTTCTTCATTTGGTTTCAATTTAATTAGTTGAA
TAATTCTACTTCTTCTTCTCCTCTCTATTTTCTTCCTTTTTTCCAATTTCTCTTTTCTTCTCGGACGATCGCCGGAGATTCAATCGGAAAATTCA
CCAACTGTTTATGGATTGCAGAAGCAGATCCCTATCAGCATCGCCGTCCGCCGTCTCCGCCGCCGTCAACAACCAATATCCGATTCTTCAGTTTT
CATCTCAACTCTCTAATCCTTCATACACTCCTTTCACCCCGTGGATACGATACCTCCGGTTCAGCTTTTCCTGATTTGTCTTTCAATTTATTGTA
TTCGAAGAGAACTCCAGAAGTTTAAACTCTTTCAAGCTATCATTTTTTTCAAAATCCGGAGCCAAAACTTAAACTTGAATTAAGGAGACACTTAT
TAAATTATAGCCAAGAAGAGGTGGTGGTGTGGCACTTAAAATGATTTAAGTGCTTTCCATGTCAACTTAAGATGGCTGCTTCTAACGAGTGTGAC
AAGTCCTCTACATAAGAAGATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E563143] SGN-U278599 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T363932 [Download][View] Facility Assigned ID: TBSK01073FB05T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0017 Quality Trim Threshold: 20.5