Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E563145

Search information 
Request: 563145Match: SGN-E563145
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C339627Clone name: 1497
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E563145Length: 573 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E563145 [] (trimmed) GGCTGCAGAATCGGCACGAGGCAAACCCTAAAACAAGAAATCGGAGAATTCATCAAAATCACCGGAAAAAATGGGAGTGGAGAAGGAAGTTATCA
GAGCCGGTAATGGCCCCAAACCACAGCCTGGTCAAACTGTTACCGTCCACTGCACTGGTTACGGGAAAGATAGAGACCTGAGTCAGAAGTTCTGG
AGCACTAAGGATCCAGGCCAGCAGCCTTTCTCTTTCAAGATCGGCCAAGGCAAAGTTATCAAAGGATGGGATGAAGGAGTACTGGGCATGCAATT
AGGAGAAGTTGCTCGATTAACGTGCACCCCTGGATTATGCTTATGGTGCTGGTGGATTTCCAGCATGGGGTATTCAGCCAAACTCAGTTCTGGTT
TTTGAGATTGAAGTCTTAGGTGCACAATGAGCAATTTGCTAACATTTGGGCAATCCTGATGGAGCTTTTGTGTACTCTATACAGTAGACAGCTTG
AGGGTATCAGAATTGCTCATGTACTCTTTGCTCTAATGCAACTTGTTGAAACAGATTAAGGCGATAATAAATGCTTTCTAGCTTTTCTCTGGAAA
AAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E563145] SGN-U275169 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T363934 [Download][View] Facility Assigned ID: TBSK01075FB07T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5