EST details — SGN-E563201

Search information 
Request: 563201Match: SGN-E563201
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C339692Clone name: 1562
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E563201Length: 493 bp (905 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E563201 [] (trimmed) GATCCCCCGGCTGCAGAATCGGCACGAGGAAGAAAATGGAGTCAAAGTTTTCTCACATCATTGTTTTCTTTCTTCTTNCAACTTCCTTTGAAACT
CTCATGGCACGAAAAGAAAGTGTTGGACCAGAAGTCATAGAACTTCTAAAGGAATTTCAATGCAATGGAAAACTAAGCTGGCCAGAACTTATTGG
TGTACCAACAAAGCTTGCTAAGGAAATAATTGAGAAGGAAAATTCACTCATAACTAATGTTCAGATACTACTGAATGGTTCTCCAGTCACAAAGG
ATTTTAGTTGTAATCGAGTTCGTCTTTTTGATAACATTTTGGGTGATGTTGTAGAAATGCCTGTGGTTCGTTAATTAATGGATTACCGAAGCAAT
TAAGTAGCCACAGGTAAAAAATAATTAGTGTTCATGTATGTTGATTATAATATCTCCATGTACTCTTACTATATATAATGAAATAAATAAGTGTG
GCTTAATTAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E563201] SGN-U268399 Solanum tuberosum Build 4 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T363999 [Download][View] Facility Assigned ID: TBSK01142FH02T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5