Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-E564286

Search information 
Request: 564286Match: SGN-E564286
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C340665Clone name: 2535
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E564286Length: 657 bp (944 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E564286 [] (trimmed) CAGAGGTCGGGTCCAAATAGTAAGTCGGGCCCTAGTTTCTTCACCCCCAACAATCTCCGTCGAACTGGCGATGGTCGATAACTTCGATGATATCA
TCAACTGGGACGATGTAGATCACTCGTCTTCCACAACGTTCTAGACAATCCCCACAATGATGATCAATTCACTCTTCATGATTCCTCCCCACAGA
CATTCCAGCAGATCGAGCAGCTTCTTATGAACGATGACGATGTCGGTCTTGTCTCTTTTGAAGACGCTGATCCTCAATTTGCTGCCGACTTTCTC
TCCGACGTCCTCGTCGATTCCCCTCTTCACTCCGATCATTCTCACTCTCCAGCTGAACAAGCCATTGGATTCACCGATTCCAAGGTTTCTAGTGG
ATCCGACGCCGATCAGGACAAACACAAGTCGCCTTCTGACGGGGACGACGAATTAAACAACCATGACCCTGTCGATAAGAAGCGCAAGAGGCAAT
TGAGGAACAGGGGATGCAGCTGTGAGGTCACGAGAGAGGAAGAAGTTGTATGTTAGGGATCTTGAGTTGAAGCAGTAGATACTTTGAATCAGAAT
GCAAAAGGCTGGGGTTGTTCTCCAGTGCTGTCTTGCCTGAAAATCAAAGCTTTACGCTTCTCTTTGCAGAATAGCAGTGCTAATGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E564286] SGN-U270357 Solanum tuberosum Build 4 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T364972 [Download][View] Facility Assigned ID: TBSK02159FD11_T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5