EST details — SGN-E564722

Search information 
Request: 564722Match: SGN-E564722
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C341101Clone name: 2971
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E564722Length: 585 bp (1060 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E564722 [] (trimmed) TTCATTTTCTTCTCCTCTCTGCTTTTATCTCTTTATACGACATCGTTTCTCCACCGCTGCTGCTGCTCAGACTTCCTTTTTACAGCTTTTTCGGT
CGATCGGTTTGTTTTCAGACCATATCTCAAAGTCAAGTCTACTCGATCCAGTTTTTTTTGCAGCAGTTGCTTAGACGGGAAAATGTTGGAGGCTC
CAAAGTTTGCGGGACTTATAGACTTAAATGAAAACCCTGATCATTATGGACTCTCACAAAATTTTTACCATAAGCTTGATGAGGGATCACACATG
TCAATCGATAGTTATGGGAGCTTGCAGATGAGCAATGGTGGAGGTTCAGTTGCAATGTCCATGGATAACAGCAGTGTTGGATCAAATGATTCGCA
CACTCGTATTTTAAACCATCAGGGTCTTAAGCGTGTTCACAATAACTATTCGGTTGCAGCTAGTGTAAATAAGGGAAAAGCTTCGCATGGGTTGA
GTGATGATGCCCTAGCTAAAGCGTTGATGGATCCTCGATTTCCTACCAATGGGCTTGAGAATTATGATGAGTGGACGATTGATTTGAGGAAGGCT
CAACATGGGGCCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E564722] SGN-U272782 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T365408 [Download][View] Facility Assigned ID: TBSK02606FB02_T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0018 Quality Trim Threshold: 14.5