EST details — SGN-E565118

Search information 
Request: 565118Match: SGN-E565118
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C339498Clone name: 1368
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E565118Length: 535 bp (895 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E565118 [] (trimmed) CATTGATGATGTGGTAAAAGGTTGTATCGGGTCACTTGACACTTCGGGTAAAAGTACCGGGTCGGGTGGGAAGAAACGGGGACCCGCTCCGTATC
GGATATTTAATTTGGGTAATACGTCTCCGGTGACAGTTCCGATGATGGTTGCGATGTTAGAGAAGCATTTGAAGGTTAAAGCTAAGAAGAATTTC
GTCGTAATGCCTGGAAACGGCGACGTTCCGTTTACTCATGCGAATATAAGTTCGGCCCGGAAAGAATTCGGGTATAAACCCACAACCGATTTGCA
AACCGGGTTGAAAAAGTTTGTTAAATGGTATCTCTCTTATTATGGCTATGATCAAGGAAAGTTGTAAATTGATAATTAATTTTTTTTTTAATTTC
ATGTTGTGGTTATTTTAGATTTTTTTTTTCTTTTTTTTAATCACAAAAGCAAAAAAAGAAAAGAAAAAAAGAAAAGGTGAATACCAATTCTTTTT
TACAAATTATTATTATTATTATTATGGGGAAAGAGGAGGGGAAAAGATTGAATAAACTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E565118] SGN-U271398 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T363805 [Download][View] Facility Assigned ID: TBSK00939FG03T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0036 Quality Trim Threshold: 12.5