EST details — SGN-E565194

Search information 
Request: 565194Match: SGN-E565194
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C341764Clone name: 3634
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E565194Length: 622 bp (983 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E565194 [] (trimmed) TTTTTTTTTTGAAAACAACTGACTTGCTTGAGCTCTTAATAATTACACTGCCATAGTTTAGTGCTTGAACAGAAACAACTTAACAGGCAAAATTT
CTCAGAGGTTGAACTGAATCCCTAATCTACCTATAATTATCAACATTTTGTCTTTTTTTGAATCCTTCTTTTAACTGAATACTGATCTTCCATAC
TGTATCTGCTTCCACAGGAGACACTGCCAAACTTCTTATCACTGGCGTCAAGAGGTTGTATCCTAGAATCTGAAAATCTACAGCTCCCACCGAAA
ATATAGCACAGGAGCATTTGCATCAGAGAGGCCACTGCAGACCGCTACCTTGATGCTTGATCAAGACCAGCGGTAGCAGAGCTCATGCCAGGGGC
AACACCATTTTCATTTGGAGGAGGTGTACCCCATTTACCTTCCGACTCTAGAGGCTCAAGCACATAAACTCCACCATCAGTAAGTCCTACTGCGC
ATTGGTTTGATTCAGATGGATGAGCAGCAACGACAAGTGGATATACTCTGGGAGCTTGGGTTAGAAGGCAAGTCAGCGGCAGGATTCACCCGACA
CCTCAGCTTGAGTGCTGCAGCAGTAAAGATACTCACACTTCCATCATCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E565194] SGN-U272947 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T366071 [Download][View] Facility Assigned ID: TBSK03287FB11.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5