EST details — SGN-E565481

Search information 
Request: 565481Match: SGN-E565481
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C342052Clone name: 3922
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E565481Length: 349 bp (429 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E565481 [] (trimmed) CAGCTCTAGTCCCTATCATTTTCCTCGCCTCACTACCGAAAGCTAGGGTTTACGGTTTCTGCAATTTCGAAGATTTTGAATCTGTAGTAATCGTA
TTGAAGGTAATCGGAAAAAGCTATGGACCCGATGAAGTTGAATCAACTGAAGCAATTCGTCGAACAGTGCAAATCCAATCCTTCCATTCTCGCCG
ATCCTTCTCTTTCATTTTTCCGTGACTACATTGAGAATCTCGGTGCTAAACTTCCTCCGGCTGCTTACGACACCGGCGATTACAAAGAGAAGTCT
CATGCGGTGGATGCGAGTGATGACGAAATGGATGATGTTGAGAATGATGCTAATACGAAAGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E565481] SGN-U269474 Solanum tuberosum Build 4 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T366359 [Download][View] Facility Assigned ID: TBSK03600FD12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5