EST details — SGN-E565640

Search information 
Request: 565640Match: SGN-E565640
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C342209Clone name: 4079
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E565640Length: 488 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E565640 [] (trimmed) CTTTANCAAGATTGACAGGCGTTCAGGTAAGGAACTTGAGAAGGAGCCTAAGTTCTTGAAGAATGGTGATGCAGGTATGGTTAAGATGATTCCCA
CCAAGCCTATGGTTGTTGAGACCTTTGCTGAGTACCCACCATTGGGTCGTTTTGCTGTGAGGGACATGAGTGCAAACTGTTGCTGTTGGCGTTGT
CAAGAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGGGAAACGTGAAGAGCACATTTGATGAGCACGGAT
GAAGTAGTTTTGTTTATTTGCGTCAGTTTTTTCCAATTTTGTTTTGGACAACATTTTACCAGTTTTGGATATGGCTACAGAAGGTATTGTCATGG
TTATCTAGCCTCTTTTCGAGGATAGTGGAGTAATTGAGAACCAAATTACTTGATGGGCAATGACATATAGCTCTCTGGTGGTTGTTTCTTTACAA
AACAACAAAAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E565640] SGN-U277725 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T366516 [Download][View] Facility Assigned ID: TBSK03761FB05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0127 Quality Trim Threshold: 12.5