Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E565643

Search information 
Request: 565643Match: SGN-E565643
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C342212Clone name: 4082
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E565643Length: 187 bp (1410 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E565643 [] (trimmed) GTTATTCTCCATACGCGGCCAGGCTTTTAGCGAAGCTCTTTCTCTCATTTTTCCGTTTGTGAAAGTTTTTTAGACATCATGGGTAAAGAGAAGAT
TCATATCAGCATTGTTGTCATTGGACATGTCGACTCTGGGAAAGTCGAGCACTACTGGGTCACTTGATCTACAAAGCTTGGGTGGTATTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E565643] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T366519 [Download][View] Facility Assigned ID: TBSK03764FB08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0257 Quality Trim Threshold: 14.5