EST details — SGN-E565643
| Search information |
| Request: 565643 | Match: SGN-E565643 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C342212 | Clone name: 4082 |
| ||
| Library Name: TBSK | Organism: Solanum tuberosum |
Tissue: Tuber Skin
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E565643 | Length: 187 bp (1410 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E565643 [] (trimmed)
GTTATTCTCCATACGCGGCCAGGCTTTTAGCGAAGCTCTTTCTCTCATTTTTCCGTTTGTGAAAGTTTTTTAGACATCATGGGTAAAGAGAAGAT
TCATATCAGCATTGTTGTCATTGGACATGTCGACTCTGGGAAAGTCGAGCACTACTGGGTCACTTGATCTACAAAGCTTGGGTGGTATTTGA
TCATATCAGCATTGTTGTCATTGGACATGTCGACTCTGGGAAAGTCGAGCACTACTGGGTCACTTGATCTACAAAGCTTGGGTGGTATTTGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E565643] | SGN-U277731 | Solanum tuberosum | Build 4 | 274 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T366519 [Download][View] | Facility Assigned ID: TBSK03764FB08.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.960 | Expected Error Rate: 0.0257 | Quality Trim Threshold: 14.5 |
Working
