EST details — SGN-E565904

Search information 
Request: 565904Match: SGN-E565904
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C342473Clone name: 4343
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E565904Length: 499 bp (674 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E565904 [] (trimmed) TGCCCCCTTTTTCTTCTTCTTTTCTGTTTGCTGCTCTTTTTTTACAGCCAAAAAGATCAGTTTTTGGGTGACACCGACAGTCTAAAACAAGAAAG
AAAGAGTTGCTATGGAGAGGAAATCGATAATAATTTGTGGGGTTGTGGGATTTCTAGGGCTATTATCTGCCGTTACTGGTTTTGCTGCTGAGGCC
ACAAGGATTAAGGGTTCTCAGGTCCAGGTTCCGACTCCTACAGAATGTGTATATCCAAGGAGTCCTGCACTGGGTCTTGGATTGACTGCTTCTGT
GGCTCTTATAGTTGCTCAAATAATTATCAATGTAGCAAGTGGATGTGTCTGCTGCCGGAAAGGCCAACATCAATCAGGCATCTAATTGGACGCTA
GCGCTAATATGTTCTCTAGTTAGTATCCTGGTCTTACATTGTGTTCATAGCATTCTCTATTGTTGCTAACAGGCGCAGCACTGAATGATACAGCA
TGGTGATGACGAGCCTGTTATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E565904] SGN-U274926 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T366780 [Download][View] Facility Assigned ID: TBSK04035FA03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0178 Quality Trim Threshold: 14.5