Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E566160

Search information 
Request: 566160Match: SGN-E566160
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C342729Clone name: 4599
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E566160Length: 428 bp (942 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E566160 [] (trimmed) CTTCACCTGTTCTCTCTCTTTAAATATGGCTGAAAATAGTGGAAACAGGATCGGAAGAAACTCAGGAACCTCTCGTGTTGCGGCTTAATGAAAGA
ATTCTCTCCTCAATGTCACGAAGATCTATTGCTGCTCATCCGTGGCATGACCTAGAAGATTGGGCCAGGTGCACCCTCAATTTTCAACTGTGTGG
TTGAAATAGGCAAAGGCAGCAAAGTCAAATATGAGGCTTGACAAAGCAAGTGGGCCTTATAAAGGTTGACCGAATACTGTACTCATCAGTTGTTT
ATCCACACAACTATGGTTTTCATCCCAAGAACCCTTTGTGAAGACAGTGATCCAATGGATGTCCTGGGTACTGATGCAGGGAACCTGTGGTTTAC
CAAAGTAACTTTCTTCGGTGCTCGTGCAATTGGATTGATTGCCTATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E566160] SGN-U281371 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T367036 [Download][View] Facility Assigned ID: TBSK04303Fg07.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0183 Quality Trim Threshold: 14.5