Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E566295

Search information 
Request: 566295Match: SGN-E566295
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C342874Clone name: 4734
nocartOrdering Not Available
Library Name: TBSKOrganism: Solanum tuberosum

Tissue: Tuber Skin
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E566295Length: 341 bp (887 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E566295 [] (trimmed) ACAGAAATTGTAAAAATGAGCAATGAAAACGATGATCTGTCTCCACAAAGACGTGCCCCTCCGTTTGAATGAGAGGATCCTATCATCTATATCCA
GGAGGTCTGTTGCTGCTCATCCTTGGCACGACCTTGAGATAGGACCTGAAGCTCCAAGTGTTTTCAATGTTGTCATTGAGATTTCAAAAGGAAGC
AAAGTCAAATATGAGCTGGGACAAGAAAACCGGTCTTATTAAGGTTGATCGCATCCTATACTCTTCAGTGGTTTACCCTCAAAACTATGGCGTTC
ATTCCCCGGAACACTCTGCTGAAGATAATGACCCCAATGGATGTATTAGTCCTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E566295] SGN-U270943 Solanum tuberosum Build 4 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T367171 [Download][View] Facility Assigned ID: TBSK04444FC04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0173 Quality Trim Threshold: 20.5