EST details — SGN-E567216

Search information 
Request: 567216Match: SGN-E567216
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C344373Clone name: 11308
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E567216Length: 640 bp (1089 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E567216 [] (trimmed) CAACAATCACCATGATTGGTACTCTATTCTTCAAATCCAAGGCCGTACTGAAGATTCAGAGCTTATCAAGAAACAGTATCGTCGTCTTGCTCTTC
TTCTTCATCCTGATAAAAACAAATACCCATCTTCAGATACTGCTTTTGGCCTTGTTGCTGATGCCTGGGCTGTTCTTTCAGATCCATCAAAAAAG
GGTCTTTACGATAATGAACTTTCCCTTTTTACTAGAGTTAAATTGACTCCTGCTGGTGGACGAGGAAGACCTAGAGGGAGTTATAATAAGCAGAA
GAAAGGAGATGCTAAGTTACCCGTGAGGAGGAGTAGTCGGGCGAGTAATTCGGGTTCGGGTCAAAATCAGAACCCGAATCCCAGTCCGGTGAGTC
AGAGGAGTTATCATAGCGTGCCGCCGAAGGCTACGGCGCCGACGCCGATGAGTGGTGCGATGAGAGGGCAAAGGGTTGTGAATTTGTGGACGGCG
TGTCCGTATTGTTACAATTTGTATGAGTATCCTAGGGTTTATGAAGGGTGTTGTTTAAGATGTGATAAATGTCAAAGGGCTTTTACTGCTACTGA
GATTTTGTCAATGCCACCAATGGTGCCAGGGAGAGAAGCTTATATTGTATTGGGGGTTTTTCCCAATGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E567216] SGN-U274249 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T368144 [Download][View] Facility Assigned ID: bf_stolxxxx_0005e12.t7m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5