EST details — SGN-E568316

Search information 
Request: 568316Match: SGN-E568316
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C345619Clone name: 12580
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E568316Length: 201 bp (1106 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E568316 [] (trimmed) CACAAATGCAATTTGCTGCTTCTTTGCTGGAGCTACTCGCCTCTTTATACTAGTCCTTGACTTCTGTGTCCGGAAGTGTATTTGCCTTGGTTATT
TATGCTGTGTATGCAGAAGAAGGTTGATCTGGATATAAATGTAATGGTTTAATAAACGGTGAACTTTTAGTGAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E568316] SGN-U269254 Solanum tuberosum Build 4 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T369390 [Download][View] Facility Assigned ID: bf_stolxxxx_0018h06.t7m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.905 Expected Error Rate: 0.0047 Quality Trim Threshold: 12.5