EST details — SGN-E569017

Search information 
Request: 569017Match: SGN-E569017
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C346413Clone name: 13390
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E569017Length: 487 bp (859 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E569017 [] (trimmed) CCTCGTGCCGGTAATCTTCACTTTGTGGAATCACCTGCACTTGCTCCCCCAGGAAGTACACATTGACTTAGCTGCACAGGCACTGCATGAAGAAG
AGCTTCAACAAGCCGCTAATCAGCCACTTCCAGATGACGATGATGAAGCATTTGAATAGAAGGCATAGCTCAGAGCGGATCAGTTTCACTGTTGC
ACCTTTCCATTTCGTTGTCCTTAAATTTTCTATATTTGGACTTCTGTCTTTGTGGTTTGAGGATTTATTTGCTGCTTCCTTGTATTATTGATTGG
TTATTAGATATGTTTGTCTGGGGCCGTGAGGCTGTGTTGTATTAGATTAGATAGTGTTCTATTCCGGTCCTGGCGTAAGTGCGTACATTGTCGAG
GCTTTTTTTTGAGCTTGTTATAATATTACTTGGTAACATATTCGACAATTTTCTCTGAAAATATTTAAATGTTAACTGATTGTGAAAAAAAAAAA
AAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E569017] SGN-U268462 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T370184 [Download][View] Facility Assigned ID: bf_stolxxxx_0027d02.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0018 Quality Trim Threshold: 12.5