EST details — SGN-E569094

Search information 
Request: 569094Match: SGN-E569094
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C346499Clone name: 13478
nocartOrdering Not Available
Library Name: STOLOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E569094Length: 439 bp (865 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E569094 [] (trimmed) AGAATGGGAAGCTCTGGTGGTATTAACTATGGTTCTTACACTTATGAGAATCTTGAGAGGGAACCTTACTGGCCATCTGAGAAACTCCGTATTTC
CATTACTGGGGCTGGAGGATTTATCGCTTCTCACATTGCTCGTCGTTTGAAGAGCGAGGGCCACTACATAATTGCCTCCGATTGGAAGAAGAATG
AGCACATGACAGAGGATATGTTCTGTCATGAGTTTCATCTTGCGGATCTTAGGGTTATGGATAATTGCTTGAAGGTAACAAAAGGTGTTGACCAT
GTCTTCAATCTCGCTGCTGATATGGGTGGCATGGGTTTCATTCAGTCCAACCACTCGGTTATCTTCTATAACAACACTATGATCAGTTCAATATG
ATGGAAGCTGCTAGATTAACAGTGTCACAAAGGTTCTTTCTATGCATCTAGTGCTTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E569094] SGN-U268615 Solanum tuberosum Build 4 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T370270 [Download][View] Facility Assigned ID: bf_stolxxxx_0028c06.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5